Stem-loop sequence cli-mir-204-2

AccessionMI0030009 (change log)
DescriptionColumba livia miR-204-2 stem-loop
Stem-loop
   -------ug     u         ca    a     g aga 
5'          ugggc ucccuuugu  uccu ugccu g   u
            ||||| |||||||||  |||| ||||| |   c
3'          acucg agggaaacg  aggg acgga u   a
   cugcugucg     u         ac    -     g gac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375795.1: 653109-653185 [+]
intergenic
Database links

Mature sequence cli-miR-204-5p

Accession MIMAT0038580
Sequence

8 - 

uucccuuugucauccuaugccu

 - 29

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-204-2-3p

Accession MIMAT0038582
Sequence

45 - 

gcagggacagcaaagggaugc

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).