Stem-loop sequence cli-mir-205a

AccessionMI0030011 (change log)
DescriptionColumba livia miR-205a stem-loop
Stem-loop
   caa      ggu   g    c           c        ucucau 
5'    uccaug   ucu uugu cuucauuccac ggagucug      a
      ||||||   ||| |||| ||||||||||| ||||||||       
3'    agguac   aga agca gaagugaggug cuuuagac      c
   uag      ---   g    u           a        caaauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375734.1: 2679531-2679623 [+]
intergenic
Database links

Mature sequence cli-miR-205a-5p

Accession MIMAT0038584
Sequence

20 - 

uccuucauuccaccggagucug

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-205a-3p

Accession MIMAT0038585
Sequence

58 - 

gauuucaguggagugaaguacg

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).