Stem-loop sequence cli-mir-206

AccessionMI0030013 (change log)
DescriptionColumba livia miR-206 stem-loop
Stem-loop
   u      a                       cc      -  au 
5'  ucucuu ugagauuacaugcuucuuuauau  ccauag gg  u
    |||||| |||||||||||||||||||||||  |||||| ||   
3'  agaggg acuuuggugugugaaggaaugua  gguauc uc  a
   -      -                       -a      g  gg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375390.1: 1979-2064 [+]
intergenic
KB387210.1: 218-303 [+]
intergenic
Clustered miRNAs
< 10kb from cli-mir-206
cli-mir-206KB375390.1: 1979-2064 [+]
cli-mir-133bKB375390.1: 6645-6729 [+]
Database links

Mature sequence cli-miR-206-5p

Accession MIMAT0038588
Sequence

16 - 

acaugcuucuuuauauccccaua

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-206-3p

Accession MIMAT0038589
Sequence

54 - 

uggaauguaaggaagugugugg

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).