Stem-loop sequence cli-mir-214

AccessionMI0030015 (change log)
DescriptionColumba livia miR-214 stem-loop
Stem-loop
   ---  a           u          aca            aacau 
5'    gg guugucaugug cugccugucu   cuugcugugcag     c
      || ||||||||||| ||||||||||   ||||||||||||     c
3'    cc caacaguacgc gacggacaga   ggacgacauguc     u
   cga  -           u          cac            cacuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375307.1: 10456129-10456223 [+]
intergenic
Clustered miRNAs
< 10kb from cli-mir-214
cli-mir-199-1KB375307.1: 10450260-10450353 [+]
cli-mir-214KB375307.1: 10456129-10456223 [+]
Database links

Mature sequence cli-miR-214-5p

Accession MIMAT0038592
Sequence

17 - 

ugccugucuacacuugcugugc

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-214-3p

Accession MIMAT0038593
Sequence

58 - 

acagcaggcacagacaggcagu

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).