Stem-loop sequence cli-mir-215

AccessionMI0030016 (change log)
DescriptionColumba livia miR-215 stem-loop
Stem-loop
   acu     c     a a  a     -   u      acu  uuuc 
5'    ggugu cagga a ug ccuau gaa ugacag   gc    u
      ||||| ||||| | || ||||| ||| ||||||   ||    a
3'    ucaca gucuu u ac ggaua cuu acuguc   cg    a
   cuu     c     a a  c     u   u      ---  uuca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375331.1: 1524393-1524481 [-]
intergenic
Clustered miRNAs
< 10kb from cli-mir-215
cli-mir-194KB375331.1: 1524707-1524791 [-]
cli-mir-215KB375331.1: 1524393-1524481 [-]
Database links

Mature sequence cli-miR-215-5p

Accession MIMAT0038594
Sequence

17 - 

augaccuaugaauugacagacu

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-215-3p

Accession MIMAT0038595
Sequence

53 - 

ccugucauuucuauaggccaaua

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).