Stem-loop sequence cli-mir-216a

AccessionMI0030017 (change log)
DescriptionColumba livia miR-216a stem-loop
Stem-loop
   acg      aa     u         cug  a        ccgcua 
5'    gcugug  uuggc uaaucucag   gc acugugag      a
      ||||||  ||||| |||||||||   || ||||||||       
3'    cgacac  aaucg auuaggguc   ug ugacacuc      u
   uag      -a     u         -ua  g        ucucaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375999.1: 130764-130855 [+]
intergenic
Clustered miRNAs
< 10kb from cli-mir-216a
cli-mir-216bKB375999.1: 125953-126039 [+]
cli-mir-216aKB375999.1: 130764-130855 [+]
cli-mir-217KB375999.1: 133563-133647 [+]
Database links

Mature sequence cli-miR-216a-5p

Accession MIMAT0038596
Sequence

18 - 

uaaucucagcuggcaacuguga

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-216a-3p

Accession MIMAT0038597
Sequence

57 - 

cacagugguaucugggauuaug

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).