Stem-loop sequence cli-mir-216b

AccessionMI0030018 (change log)
DescriptionColumba livia miR-216b stem-loop
Stem-loop
   guc  -   c  -    a          c  a     ---  u  u 
5'    gc aga ug ggaa ucucugcagg aa uguga   ug cu u
      || ||| || |||| |||||||||| || |||||   || ||  
3'    cg ucu ac ucuu agagaugucc uu acacu   ac ga a
   cca  g   a  a    -          a  a     cua  -  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375999.1: 125953-126039 [+]
intergenic
Clustered miRNAs
< 10kb from cli-mir-216b
cli-mir-216bKB375999.1: 125953-126039 [+]
cli-mir-216aKB375999.1: 130764-130855 [+]
cli-mir-217KB375999.1: 133563-133647 [+]
Database links

Mature sequence cli-miR-216b-5p

Accession MIMAT0038598
Sequence

14 - 

aaaucucugcaggcaaauguga

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-216b-3p

Accession MIMAT0038599
Sequence

54 - 

acaauuaccuguagagauucua

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).