Stem-loop sequence cli-mir-217

AccessionMI0030019 (change log)
DescriptionColumba livia miR-217 stem-loop
Stem-loop
   uuu     c c  a  c     c          u -   aau 
5'    gaugu g ag ua ugcau aggaacugau g gau   a
      ||||| | || || ||||| |||||||||| | |||    
3'    cuacg c uc gu acgua uccuugacua c cug   a
   aau     a u  c  u     a          c a   acu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375999.1: 133563-133647 [+]
intergenic
Clustered miRNAs
< 10kb from cli-mir-217
cli-mir-216bKB375999.1: 125953-126039 [+]
cli-mir-216aKB375999.1: 130764-130855 [+]
cli-mir-217KB375999.1: 133563-133647 [+]
Database links

Mature sequence cli-miR-217-5p

Accession MIMAT0038600
Sequence

14 - 

auacugcaucaggaacugauug

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-217-3p

Accession MIMAT0038601
Sequence

53 - 

aucaguuccuaaugcauugccu

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).