Stem-loop sequence cli-mir-218-1

AccessionMI0030020 (change log)
DescriptionColumba livia miR-218-1 stem-loop
Stem-loop
   uaau  a   a   u      u         cu        gguugugag 
5'     gu gcg gau uucugu gugcuugau  aaccaugu         g
       || ||| ||| |||||| |||||||||  ||||||||          
3'     cg cgc cug aaggua cacgaacug  uugguaca         u
   --uu  a   a   c      c         uc        aaaugagua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375368.1: 14206860-14206959 [-]
intergenic
Database links

Mature sequence cli-miR-218-5p

Accession MIMAT0038602
Sequence

21 - 

uugugcuugaucuaaccaugu

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-218-3p

Accession MIMAT0038603
Sequence

64 - 

augguucugucaagcaccaug

 - 84

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).