Stem-loop sequence cli-mir-223

AccessionMI0030025 (change log)
DescriptionColumba livia miR-223 stem-loop
Stem-loop
   agc        g    gcgu              gagucc       ag 
5'    gcggugcc cgcu    guauuugacaagcu      gacacuc  u
      |||||||| ||||    ||||||||||||||      |||||||  g
3'    cgucacgg gcga    cauaaacuguuuga      cugugag  c
   agu        a    accc              ------       ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375664.1: 204593-204687 [+]
intergenic
Database links

Mature sequence cli-miR-223-5p

Accession MIMAT0038609
Sequence

18 - 

cguguauuugacaagcugagucc

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-223-3p

Accession MIMAT0038610
Sequence

58 - 

ugucaguuugucaaauacccca

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).