Stem-loop sequence cli-mir-301a

AccessionMI0030026 (change log)
DescriptionColumba livia miR-301a stem-loop
Stem-loop
        aa  aac   c    ---u          a  -  acu 
5' cugcu  cg   gcu ugac    uuauugcacu cu gu   u
   |||||  ||   ||| ||||    |||||||||| || ||    
3' gacga  gc   cga acug    gauaacguga ga cg   c
        aa  cua   a    uuau          c  u  acc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375855.1: 631245-631328 [+]
intergenic
Clustered miRNAs
< 10kb from cli-mir-301a
cli-mir-130aKB375855.1: 630666-630747 [+]
cli-mir-301aKB375855.1: 631245-631328 [+]
Database links

Mature sequence cli-miR-301a-5p

Accession MIMAT0038611
Sequence

13 - 

gcucugacuuuauugcacuacu

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-301a-3p

Accession MIMAT0038612
Sequence

50 - 

cagugcaauaguauugucaaagcau

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).