Stem-loop sequence cli-mir-301b

AccessionMI0030027 (change log)
DescriptionColumba livia miR-301b stem-loop
Stem-loop
   ---     u    cug   c         ---      a  gucugc 
5'    gcugg aucg   gcu ugacaaugu   ugcacu cu      a
      ||||| ||||   ||| |||||||||   |||||| ||       
3'    ugacc uggu   cga acuguuaua   acguga ga      c
   ucc     u    uua   a         aua      c  aauaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB376592.1: 504205-504294 [-]
intergenic
Clustered miRNAs
< 10kb from cli-mir-301b
cli-mir-130cKB376592.1: 505475-505561 [-]
cli-mir-301bKB376592.1: 504205-504294 [-]
cli-mir-454KB376592.1: 497716-497804 [-]
Database links

Mature sequence cli-miR-301b-5p

Accession MIMAT0038613
Sequence

16 - 

ucugacaauguugcacuacu

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-301b-3p

Accession MIMAT0038614
Sequence

52 - 

cagugcaauaauauugucaaagc

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).