Stem-loop sequence cli-mir-302a

AccessionMI0030028 (change log)
DescriptionColumba livia miR-302a stem-loop
Stem-loop
       a   u         u           guu 
5' ccau acu aaaugugga guacuugcuuu   c
   |||| ||| ||||||||| |||||||||||    
3' ggua ugg uuuguaccu cgugaaugaaa   c
       g   u         u           agu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB376606.1: 1626446-1626513 [+]
intergenic
Clustered miRNAs
< 10kb from cli-mir-302a
cli-mir-302b-1KB376606.1: 1626021-1626089 [+]
cli-mir-302cKB376606.1: 1626294-1626381 [+]
cli-mir-302aKB376606.1: 1626446-1626513 [+]
cli-mir-302b-2KB376606.1: 1626801-1626870 [+]
cli-mir-367KB376606.1: 1626971-1627045 [+]
Database links

Mature sequence cli-miR-302a-3p

Accession MIMAT0038615
Sequence

44 - 

aagugcuuccauguuuuggugau

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).