Stem-loop sequence cli-mir-338a

AccessionMI0030032 (change log)
DescriptionColumba livia miR-338a stem-loop
Stem-loop
   aau       u         cu   -         uca    aagu 
5'    guuuacu cuagcaaca  auc cugaugcug   gagu    g
      ||||||| |||||||||  ||| |||||||||   ||||     
3'    uaaaugg gauuguugu  uag gacuacgac   cucg    g
   acu       u         uu   u         ---    aaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB376357.1: 334950-335039 [+]
intergenic
Database links

Mature sequence cli-miR-338a-5p

Accession MIMAT0038618
Sequence

17 - 

aacacuauccugaugcugucagagu

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-338a-3p

Accession MIMAT0038619
Sequence

54 - 

uccagcaucagugauuuuguugu

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).