Stem-loop sequence cli-mir-365-1

AccessionMI0030035 (change log)
DescriptionColumba livia miR-365-1 stem-loop
Stem-loop
   acc      aa        ac           ----   -    uu 
5'    gcaggg  aaugaggg  uuuugggggca    gau gugu  c
      ||||||  ||||||||  |||||||||||    ||| ||||  c
3'    cguucu  uuauuccu  aaaauccccgu    cua caca  a
   uga      cg        -a           aaua   u    uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375532.1: 992939-993027 [+]
intergenic
Clustered miRNAs
< 10kb from cli-mir-365-1
cli-mir-193KB375532.1: 987719-987798 [+]
cli-mir-365-1KB375532.1: 992939-993027 [+]
Database links

Mature sequence cli-miR-365-5p

Accession MIMAT0038624
Sequence

16 - 

agggacuuuugggggcagaugug

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-365-3p

Accession MIMAT0038625
Sequence

56 - 

uaaugccccuaaaaauccuua

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).