Stem-loop sequence cli-mir-383

AccessionMI0030039 (change log)
DescriptionColumba livia miR-383 stem-loop
Stem-loop
     c     -c  a      aa    a        uugaaua   a 
5' ac ugcuc  uc gaucag  ggug uuguggcu       gcu u
   || |||||  || ||||||  |||| ||||||||       |||  
3' ug acgag  ag cugguc  ucac gacaccga       cga u
     a     aa  a      ca    -        -------   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375368.1: 1608633-1608715 [+]
intergenic
Database links

Mature sequence cli-miR-383-5p

Accession MIMAT0038630
Sequence

11 - 

cagaucagaaggugauuguggcu

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-383-3p

Accession MIMAT0038631
Sequence

53 - 

ccacagcacuaccuggucaga

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).