Stem-loop sequence cli-mir-425

AccessionMI0030040 (change log)
DescriptionColumba livia miR-425 stem-loop
Stem-loop
   ---      cg        au       u  cu    c  --ag      
5'    gagaga  gcuuugga  gacacga ca  cccg ug    cgggc 
      ||||||  ||||||||  ||||||| ||  |||| ||    |||| a
3'    cuuucu  cgaaaccu  cugugcu gu  gggc ac    guccg 
   ugg      --        gu       -  ag    u  cgga      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375561.1: 2757261-2757351 [+]
intergenic
Clustered miRNAs
< 10kb from cli-mir-425
cli-mir-425KB375561.1: 2757261-2757351 [+]
cli-mir-2970KB375561.1: 2757526-2757619 [+]
Database links

Mature sequence cli-miR-425-5p

Accession MIMAT0038632
Sequence

16 - 

aaugacacgaucacucccgcugag

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-425-3p

Accession MIMAT0038633
Sequence

55 - 

caucggggaugucgugucugucc

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).