Stem-loop sequence cli-mir-449c

AccessionMI0030044 (change log)
DescriptionColumba livia miR-449c stem-loop
Stem-loop
   --a     u      c   c  ug  u      u        ugu u 
5'    gaaug aacagu ugg ag  ca guuagc ggcuguug   c g
      ||||| |||||| ||| ||  || |||||| ||||||||   |  
3'    cuuac uuguua acc uc  gu cgaucg ucgacaac   g a
   aaa     u      c   -  gu  -      -        ugu u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375359.1: 2804268-2804358 [-]
intergenic
Clustered miRNAs
< 10kb from cli-mir-449c
cli-mir-449cKB375359.1: 2804268-2804358 [-]
cli-mir-449bKB375359.1: 2803297-2803383 [-]
cli-mir-449aKB375359.1: 2803138-2803226 [-]
cli-mir-449dKB375359.1: 2802140-2802228 [-]
Database links

Mature sequence cli-miR-449c-5p

Accession MIMAT0038639
Sequence

15 - 

uggcagugcauguuagcuggcuguu

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-449c-3p

Accession MIMAT0038640
Sequence

56 - 

cagcugcuagcugugcuccac

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).