Stem-loop sequence cli-mir-454

AccessionMI0030047 (change log)
DescriptionColumba livia miR-454 stem-loop
Stem-loop
   -------u     u          ---         -  -       ug 
5'         aagga gagacccuau   caauauugc cu cugcuuu  u
           ||||| ||||||||||   ||||||||| || |||||||  g
3'         uuucu uucugggaua   guuauaacg ga gauggga  a
   uugggagu     u          uuc         u  u       cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB376592.1: 497716-497804 [-]
intergenic
Clustered miRNAs
< 10kb from cli-mir-454
cli-mir-130cKB376592.1: 505475-505561 [-]
cli-mir-301bKB376592.1: 504205-504294 [-]
cli-mir-454KB376592.1: 497716-497804 [-]
Database links

Mature sequence cli-miR-454-5p

Accession MIMAT0038644
Sequence

11 - 

acccuaucaauauugccucugcu

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-454-3p

Accession MIMAT0038645
Sequence

50 - 

uagugcaauauugcuuauagggucu

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).