Stem-loop sequence cli-mir-455

AccessionMI0030048 (change log)
DescriptionColumba livia miR-455 stem-loop
Stem-loop
     c   u ug  g          u      a   c   gaa 
5' cc ugg g  ag guaugugccc uggacu cau gug   g
   || ||| |  || |||||||||| |||||| ||| |||    
3' gg acu c  uc cauauacggg accuga gua cac   c
     a   c gu  a          u      c   c   gac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB376218.1: 271151-271234 [-]
intergenic
Database links

Mature sequence cli-miR-455-5p

Accession MIMAT0038646
Sequence

15 - 

uaugugcccuuggacuacaucgu

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-455-3p

Accession MIMAT0038647
Sequence

52 - 

ugcaguccaugggcauauacac

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).