Stem-loop sequence cli-mir-456

AccessionMI0030049 (change log)
DescriptionColumba livia miR-456 stem-loop
Stem-loop
   --        g   g     uc       acac ug    c 
5'   guguguga cag caucu  ucagccu    g  gauu c
     |||||||| ||| |||||  |||||||    |  ||||  
3'   uacguacu guu guaga  ggucgga    c  cuaa u
   cu        -   g     uu       ---- gu    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375412.1: 2388545-2388621 [+]
intergenic
Database links

Mature sequence cli-miR-456-3p

Accession MIMAT0038648
Sequence

49 - 

caggcugguuagaugguuguc

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).