Stem-loop sequence cli-mir-458

AccessionMI0030050 (change log)
DescriptionColumba livia miR-458 stem-loop
Stem-loop
   cg       g       cg      cc        aa       
5'   uggugca auggcag  ccauuu  agagcuau  acaguc 
     ||||||| |||||||  ||||||  ||||||||  ||||| u
3'   gccaugu uaccguc  gguaag  ucucgaua  uguuac 
   ag       a       au      uu        -c       
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375905.1: 126017-126102 [+]
intergenic
Database links

Mature sequence cli-miR-458-5p

Accession MIMAT0038649
Sequence

16 - 

agcgccauuuccagagcuauaa

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-458-3p

Accession MIMAT0038650
Sequence

52 - 

auagcucuuugaaugguacugc

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).