Stem-loop sequence cli-mir-460a

AccessionMI0030052 (change log)
DescriptionColumba livia miR-460a stem-loop
Stem-loop
   acc       -    cac ug       ca a        a  g 
5'    ugacuuu auag   c  cauugua  c cugugugu uu a
      ||||||| ||||   |  |||||||  | |||||||| || c
3'    acugaag uguc   g  guaacau  g gacacgua ag u
   cuc       a    uua gu       ac c        a  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375875.1: 1526032-1526121 [+]
intergenic
Database links

Mature sequence cli-miR-460a-5p

Accession MIMAT0038652
Sequence

17 - 

ccugcauuguacacacugugug

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-460a-3p

Accession MIMAT0038653
Sequence

54 - 

cacagcgcauacaauguggauu

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).