Stem-loop sequence cli-mir-460b

AccessionMI0030053 (change log)
DescriptionColumba livia miR-460b stem-loop
Stem-loop
   cuc  -       a      u       ca         ua u 
5'    ug gcucuau gugucc cauugua  ugcugugug  u u
      || ||||||| |||||| |||||||  |||||||||  | g
3'    ac cgaggua uacagg guaacgu  gcgacacau  a u
   uua  u       a      u       ac         gc c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375349.1: 1902280-1902367 [+]
intergenic
Database links

Mature sequence cli-miR-460b-5p

Accession MIMAT0038654
Sequence

17 - 

uccucauuguacaugcugugu

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-460b-3p

Accession MIMAT0038655
Sequence

53 - 

acagcgcaugcaauguggaca

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).