Stem-loop sequence cli-mir-490

AccessionMI0030055 (change log)
DescriptionColumba livia miR-490 stem-loop
Stem-loop
   uuc           c      --         g   caag   a 
5'    augguucgaca caugga  ucuccaggu ggu    auu u
      ||||||||||| ||||||  ||||||||| |||    ||| a
3'    ugucgaguugu guaccu  ggaggucca cca    uag g
   acu           c      ca         a   --ca   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375618.1: 335613-335699 [-]
intergenic
Database links

Mature sequence cli-miR-490-5p

Accession MIMAT0038658
Sequence

15 - 

ccauggaucuccagguggguca

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-490-3p

Accession MIMAT0038659
Sequence

54 - 

caaccuggaggacuccaugcugu

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).