Stem-loop sequence cli-mir-499

AccessionMI0030056 (change log)
DescriptionColumba livia miR-499 stem-loop
Stem-loop
   uuu      - cg   guua       u           ga   u 
5'    gagaga g  gca    agacuug agugauguuua  uaa g
      |||||| |  |||    ||||||| |||||||||||  |||  
3'    cucucu c  cgu    ucugaau ucacuacaagu  auu u
   cuc      u au   ---g       u           ac   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375381.1: 2000097-2000184 [-]
intergenic
Database links

Mature sequence cli-miR-499-5p

Accession MIMAT0038660
Sequence

17 - 

uuaagacuuguagugauguuua

 - 38

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-499-3p

Accession MIMAT0038661
Sequence

55 - 

aacaucacuuuaagucugugcu

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).