Stem-loop sequence cli-mir-551b

AccessionMI0030058 (change log)
DescriptionColumba livia miR-551b stem-loop
Stem-loop
   -----c         a         gg     aagaccucguca 
5'       cauggcucc gaaaucaag  ugggu            g
         ||||||||| |||||||||  |||||            c
3'       gugucgggg cuuugguuc  accca            a
   cucggu         a         au     gcggaauuugaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB376001.1: 3540879-3540964 [-]
intergenic
Database links

Mature sequence cli-miR-551b-5p

Accession MIMAT0038664
Sequence

11 - 

agaaaucaaggguggguaagaccu

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-551b-3p

Accession MIMAT0038665
Sequence

52 - 

gcgacccauacuugguuucagg

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).