Stem-loop sequence cli-mir-737

AccessionMI0030060 (change log)
DescriptionColumba livia miR-737 stem-loop
Stem-loop
   --ug    gg  u -ag        g            au    u 
5'     guuu  gu g   uuuuuuua guuuugauuuuu  uaca c
       ||||  || |   |||||||| ||||||||||||  ||||  
3'     uaga  cg c   aaagaaau caaaacuaaaaa  augu u
   uaga    aa  u gua        g            -c    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375519.1: 3380822-3380909 [-]
intergenic
Database links

Mature sequence cli-miR-737-5p

Accession MIMAT0038667
Sequence

14 - 

guuuuuuuagguuuugauuuuu

 - 35

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).