Stem-loop sequence cli-mir-875

AccessionMI0030061 (change log)
DescriptionColumba livia miR-875 stem-loop
Stem-loop
   --       u  aau        c       a  uucu 
5'   uuagugg ac   accucagu uuuucgg ug    a
     ||||||| ||   |||||||| ||||||| ||    u
3'   agucacu ug   uggaguca aaagguc ac    a
   ca       u  cgu        u       c  uuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375314.1: 1574513-1574589 [+]
intergenic
Clustered miRNAs
< 10kb from cli-mir-875
cli-mir-875KB375314.1: 1574513-1574589 [+]
cli-mir-599KB375314.1: 1574678-1574749 [+]
Database links

Mature sequence cli-miR-875-5p

Accession MIMAT0038668
Sequence

11 - 

aauaccucagucuuuucggaug

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-875-3p

Accession MIMAT0038669
Sequence

46 - 

ccuggaaauacugagguugcgu

 - 67

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).