Stem-loop sequence cli-mir-1306

AccessionMI0030062 (change log)
DescriptionColumba livia miR-1306 stem-loop
Stem-loop
   ca -  uc       uccccu  a        gug  gc 
5'   g cc  caccacc      gc aacgucca   ac  a
     | ||  |||||||      || ||||||||   ||   
3'   c gg  guggugg      cg uugcaggu   ug  g
   ga a  ua       ---ucu  g        -aa  ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375297.1: 625480-625554 [+]
intergenic
Clustered miRNAs
< 10kb from cli-mir-1306
cli-mir-3618KB375297.1: 625171-625247 [+]
cli-mir-1306KB375297.1: 625480-625554 [+]
Database links

Mature sequence cli-miR-1306-5p

Accession MIMAT0038670
Sequence

10 - 

ccaccuccccugcaaacgucc

 - 30

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-1306-3p

Accession MIMAT0038671
Sequence

50 - 

acguuggcucugguggugaug

 - 70

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).