Stem-loop sequence cli-mir-1451

AccessionMI0030066 (change log)
DescriptionColumba livia miR-1451 stem-loop
Stem-loop
   -a   g          ug    g                c   uuca 
5'   agc caggagcugc  ccuc cacaggggcaaguuac gcg    g
     ||| ||||||||||  |||| |||||||||||||||| |||    c
3'   ucg guccucggcg  ggag guguccucguucaaug cgu    u
   cc   -          gu    a                a   ccac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375373.1: 1351137-1351231 [+]
intergenic
Database links

Mature sequence cli-miR-1451-5p

Accession MIMAT0038678
Sequence

20 - 

ucgcacaggggcaaguuaccgc

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-1451-3p

Accession MIMAT0038679
Sequence

57 - 

aguaacuugcuccugugagagg

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).