Stem-loop sequence cli-mir-1550

AccessionMI0030068 (change log)
DescriptionColumba livia miR-1550 stem-loop
Stem-loop
   aga   ----      g  ----    c    g      c    c    gcug 
5'    ccu    gugcag cu    ucag ugau ggggug agug agua    u
      |||    |||||| ||    |||| |||| |||||| |||| ||||    u
3'    gga    cacguc ga    gguc acua uccuau ucac ucgu    u
   --g   ccac      -  auuu    -    g      -    u    acua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375680.1: 255712-255807 [+]
intergenic
Database links

Mature sequence cli-miR-1550-5p

Accession MIMAT0038682
Sequence

21 - 

ugaugggggugcagugcagua

 - 41

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).