Stem-loop sequence cli-mir-1559

AccessionMI0030070 (change log)
DescriptionColumba livia miR-1559 stem-loop
Stem-loop
   -aca    -   c   a   cu        u      cu     caagaa 
5'     ugaa ggu uag cuc  uucgaugc uguaug  acucc      u
       |||| ||| ||| |||  |||||||| ||||||  |||||       
3'     auuu cca auc gag  gagcuacg auguac  ugagg      g
   ucaa    a   u   a   ac        u      cu     acaauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375430.1: 524646-524745 [-]
intergenic
Database links

Mature sequence cli-miR-1559-5p

Accession MIMAT0038685
Sequence

21 - 

uucgaugcuuguaugcuacucc

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-1559-3p

Accession MIMAT0038686
Sequence

61 - 

uuccauguaugcaucgagcag

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).