Stem-loop sequence cli-mir-1641

AccessionMI0030071 (change log)
DescriptionColumba livia miR-1641 stem-loop
Stem-loop
   ---------au      c        a             u      ucau 
5'            gcaggg auuuccug ggauuaaugacug cugggg    c
              |||||| |||||||| ||||||||||||| ||||||    a
3'            ugucuc uaaaggac ccuaauuauugau gacccu    u
   uacuaguuccg      a        c             u      ccuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375757.1: 1454655-1454750 [-]
intergenic
Database links

Mature sequence cli-miR-1641-5p

Accession MIMAT0038687
Sequence

16 - 

ugaggauuaaugacugucugggg

 - 38

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).