Stem-loop sequence cli-mir-1655

AccessionMI0030072 (change log)
DescriptionColumba livia miR-1655 stem-loop
Stem-loop
   ggggaaaccgcauuu  a a  g        g   c       --   -   uu 
5'                ca c cu ugucagcu guc uggguaa  acu ccg  g
                  || | || |||||||| ||| |||||||  ||| |||   
3'                gu g gg auagucga cgg acccauu  uga ggc  u
   --------------g  c c  g        a   c       ua   c   cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375367.1: 4592061-4592153 [+]
intergenic
Database links

Mature sequence cli-miR-1655-3p

Accession MIMAT0038688
Sequence

63 - 

auuuacccacggcaagcugaua

 - 84

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).