Stem-loop sequence cli-mir-1662

AccessionMI0030073 (change log)
DescriptionColumba livia miR-1662 stem-loop
Stem-loop
   --a       g  cua              u aua        guaug 
5'    uagcugu cu   uggguuugacauca c   cuugggau     a
      ||||||| ||   |||||||||||||| |   ||||||||      
3'    gucggua ga   acccggacuguagu g   gaacccug     c
   acc       -  ---              c gac        aaaca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375752.1: 607984-608075 [-]
intergenic
Database links

Mature sequence cli-miR-1662-5p

Accession MIMAT0038689
Sequence

20 - 

uugacaucaucauacuugggau

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-1662-3p

Accession MIMAT0038690
Sequence

56 - 

cccaagcaggcugaugucaggc

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).