Stem-loop sequence cli-mir-1677

AccessionMI0030074 (change log)
DescriptionColumba livia miR-1677 stem-loop
Stem-loop
   cuguguu  u      - u        a  -gc            aag 
5'        gc uagggu c gauccugc cc   ugaagucaaugg   u
          || |||||| | |||||||| ||   ||||||||||||    
3'        cg auucca g uuaggacg gg   acuucaguuacu   u
   --uaucu  u      a u        a  aua            guu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB376567.1: 480140-480233 [+]
intergenic
Database links

Mature sequence cli-miR-1677-5p

Accession MIMAT0038691
Sequence

21 - 

uccugcaccgcugaagucaaug

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-1677-3p

Accession MIMAT0038692
Sequence

55 - 

uugacuucaauaggagcaggauu

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).