Stem-loop sequence cli-mir-1781

AccessionMI0030077 (change log)
DescriptionColumba livia miR-1781 stem-loop
Stem-loop
   g c   aca                    ag           aaucaa 
5'  g aag   aggagcuuguuuaacagcug  ugauuuaaagc      a
    | |||   ||||||||||||||||||||  |||||||||||      u
3'  c uuc   uucucggacaaguugucgac  acuaaauuucg      u
   a -   --g                    cu           auuucc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375439.1: 3197312-3197407 [+]
intergenic
Database links

Mature sequence cli-miR-1781-3p

Accession MIMAT0038697
Sequence

60 - 

uuuaaaucauccagcuguuga

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).