Stem-loop sequence cli-mir-1782

AccessionMI0030078 (change log)
DescriptionColumba livia miR-1782 stem-loop
Stem-loop
       cu      a    a -    u      a     u      aua 
5' uaga  gccugg uucu g cccu cuccaa ugaau uuuaau   a
   ||||  |||||| |||| | |||| |||||| ||||| ||||||    
3' gucu  uggacc aagg c ggga gagguu acuua aaauua   a
       -c      c    a a    c      -     c      aua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375360.1: 256897-256989 [+]
intergenic
Database links

Mature sequence cli-miR-1782-3p

Accession MIMAT0038698
Sequence

57 - 

acauucauuggagcagggaca

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).