Stem-loop sequence cli-mir-1784

AccessionMI0030079 (change log)
DescriptionColumba livia miR-1784 stem-loop
Stem-loop
   -a         g                  g  a      --  a 
5'   uuucuuggg cccaauucugcucuuauu aa ucagug  ag g
     ||||||||| |||||||||||||||||| || ||||||  ||  
3'   gaagaaucc ggguuaagacgaggguaa uu aguuac  uc u
   ca         a                  a  c      cg  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375612.1: 10503076-10503164 [-]
intergenic
Database links

Mature sequence cli-miR-1784-5p

Accession MIMAT0038699
Sequence

17 - 

uucugcucuuauugaaaucagu

 - 38

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).