Stem-loop sequence cli-mir-1788

AccessionMI0030080 (change log)
DescriptionColumba livia miR-1788 stem-loop
Stem-loop
   cu      g            c        c    ugu 
5'   gucucc gggcuuguuuuc guugccug gguu   u
     |||||| |||||||||||| |||||||| ||||   c
3'   cggagg ucugaacgaaag cgacggac ucag   c
   gu      g            -        -    uga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375305.1: 1391510-1391586 [-]
intergenic
Clustered miRNAs
< 10kb from cli-mir-1788
cli-mir-1788KB375305.1: 1391510-1391586 [-]
cli-mir-9618KB375305.1: 1390768-1390858 [-]
Database links

Mature sequence cli-miR-1788-5p

Accession MIMAT0038700
Sequence

11 - 

ggcuuguuuuccguugccugcg

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-1788-3p

Accession MIMAT0038701
Sequence

49 - 

caggcagcgaaagcaagucug

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).