Stem-loop sequence cli-mir-1791

AccessionMI0030081 (change log)
DescriptionColumba livia miR-1791 stem-loop
Stem-loop
   -uca c       c     ug g             gc a     ug 
5'     g ugaugca cgugu  g cugcaucagucau  c uguua  a
       | ||||||| |||||  | |||||||||||||  | |||||  a
3'     c acugugu gugca  c gacguagucagug  g acaau  a
   gaga -       a     gu g             ua c     cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB376214.1: 589385-589479 [+]
intergenic
Database links

Mature sequence cli-miR-1791-3p

Accession MIMAT0038702
Sequence

57 - 

cgaugugacugaugcaggcuga

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).