Stem-loop sequence cli-mir-1803-1

AccessionMI0030082 (change log)
DescriptionColumba livia miR-1803-1 stem-loop
Stem-loop
       agcuu     a   ac    g       u            u 
5' gaag     ggggc uga  caga cccauug agucaaugggag c
   ||||     ||||| |||  |||| ||||||| ||||||||||||  
3' cuuc     uuccg acu  guuu gggugac ucaguuaccuuu u
       ---au     g   aa    g       u            u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375464.1: 2790606-2790696 [+]
intergenic
Database links

Mature sequence cli-miR-1803-5p

Accession MIMAT0038703
Sequence

22 - 

agagcccauuguagucaaugg

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-1803-3p

Accession MIMAT0038704
Sequence

55 - 

auugacuucagugggguuuga

 - 75

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).