Stem-loop sequence cli-mir-2131

AccessionMI0030085 (change log)
DescriptionColumba livia miR-2131 stem-loop
Stem-loop
   ugc   u ug  u     g      ugc    a        uuu   au 
5'    ucu g  gc uccau cagaag   acgg aacagcua   gcu  u
      ||| |  || ||||| ||||||   |||| ||||||||   |||  g
3'    agg c  cg aggua gucuuc   uguc uugucggu   uga  a
   -uu   u gu  u     -      --u    a        ---   aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375742.1: 26727-26820 [-]
intergenic
Database links

Mature sequence cli-miR-2131-5p

Accession MIMAT0038707
Sequence

17 - 

augcagaagugcacggaaacagcu

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-2131-3p

Accession MIMAT0038708
Sequence

61 - 

cuguuacuguucuucugaugg

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).