Stem-loop sequence cli-mir-2188

AccessionMI0030086 (change log)
DescriptionColumba livia miR-2188 stem-loop
Stem-loop
   caga         a     ca   u  c       guauag 
5'     ccuguggga agguc  acc ca auguccu      a
       ||||||||| |||||  ||| || |||||||       
3'     ggacacccu uccag  ugg gu uauaggg      a
   -ccc         a     ac   u  a       agaaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375772.1: 1693221-1693303 [-]
intergenic
Database links

Mature sequence cli-miR-2188-5p

Accession MIMAT0038709
Sequence

14 - 

aagguccaaccucacaugucc

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-2188-3p

Accession MIMAT0038710
Sequence

53 - 

auauauguggucagaccuauc

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).