Stem-loop sequence cli-mir-2954

AccessionMI0030087 (change log)
DescriptionColumba livia miR-2954 stem-loop
Stem-loop
   -  uc   g uu     ag     a   -  cu      ga   uu  ag 
5'  ug  ugg c  ggagc  ugcug gag gg  ugggga  gga  gu  u
    ||  ||| |  |||||  ||||| ||| ||  ||||||  |||  ||   
3'  ac  acc g  ucucg  acgau cuc cc  accccu  ccu  cg  g
   c  cc   g uc     --     c   a  uu      -a   --  ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375742.1: 14798-14892 [+]
intergenic
Database links

Mature sequence cli-miR-2954-5p

Accession MIMAT0038711
Sequence

19 - 

ugcugagagggcuuggggagagga

 - 42

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-2954-3p

Accession MIMAT0038712
Sequence

57 - 

cauccccauuccacuccuagcagc

 - 80

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).