Stem-loop sequence cli-mir-2984

AccessionMI0030089 (change log)
DescriptionColumba livia miR-2984 stem-loop
Stem-loop
   u            - a        g   c       agaaa  aca  g 
5'  gcuucaccugcg g gccugcug gag gaaauug     gg   gc c
    |||||||||||| | |||||||| ||| |||||||     ||   ||  
3'  cgaaguggacgu c cgggcgac cuc cuuuaac     cc   cg c
   a            u a        a   a       --gga  ---  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375444.1: 918724-918817 [+]
intergenic
Database links

Mature sequence cli-miR-2984-5p

Accession MIMAT0038715
Sequence

15 - 

agccugcugggagcgaaauuga

 - 36

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).