Stem-loop sequence cli-mir-3618

AccessionMI0030091 (change log)
DescriptionColumba livia miR-3618 stem-loop
Stem-loop
   -  a        ga   c  a    ug       gauu 
5'  ga ugcauugu  uuu ca uaau  agacagu    c
    || ||||||||  ||| || ||||  |||||||     
3'  cu auguaaca  aaa gu auua  ucugucg    u
   a  g        ag   a  a    ca       aaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375297.1: 625171-625247 [+]
intergenic
Clustered miRNAs
< 10kb from cli-mir-3618
cli-mir-3618KB375297.1: 625171-625247 [+]
cli-mir-1306KB375297.1: 625480-625554 [+]
Database links

Mature sequence cli-miR-3618-5p

Accession MIMAT0038717
Sequence

11 - 

ugauuuccaauaauugagacag

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-3618-3p

Accession MIMAT0038718
Sequence

49 - 

cuacauuaaugaaaagaacaau

 - 70

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).