Stem-loop sequence cli-mir-9616

AccessionMI0030093 (change log)
DescriptionColumba livia miR-9616 stem-loop
Stem-loop
   -  u        c       gg    gca    ---------     u 
5'  ag gggggcug ggccugg  cagc   aacc         ccacu u
    || |||||||| |||||||  ||||   ||||         |||||  
3'  uc ccuccggu ccggacc  gucg   uugg         ggugg a
   c  c        -       ua    -ag    aacacaaaa     g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375305.1: 1124429-1124514 [-]
intergenic
Database links

Mature sequence cli-miR-9616-5p

Accession MIMAT0038721
Sequence

10 - 

ugcggccuggggcagcgcaaacc

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-9616-3p

Accession MIMAT0038722
Sequence

58 - 

uugagcugauccaggccuggc

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).