Stem-loop sequence cli-mir-9617

AccessionMI0030094 (change log)
DescriptionColumba livia miR-9617 stem-loop
Stem-loop
   ugc                   a        gagcccca 
5'    cuguugucuuaugaucaua ggauaaau        u
      ||||||||||||||||||| ||||||||        c
3'    gacgacagaauacuaguau ccuauuua        g
   cca                   g        auuaauga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CLiv1.0; GCA_000337935.1) Overlapping transcripts
KB375351.1: 67740-67820 [+]
intergenic
Database links

Mature sequence cli-miR-9617-5p

Accession MIMAT0038723
Sequence

12 - 

uuaugaucauaaggauaaauga

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cli-miR-9617-3p

Accession MIMAT0038724
Sequence

51 - 

auuuauccguaugaucauaaga

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24798503 "Toward consilience in reptile phylogeny: miRNAs support an archosaur, not lepidosaur, affinity for turtles" Field DJ, Gauthier JA, King BL, Pisani D, Lyson TR, Peterson KJ Evol Dev. 16:189-196(2014).